Source: Discussion 2, Lectures 4–5
Tags: genetics, DNA, RNA, central dogma, replication, transcription, translation, codons, Mendel, Hershey-Chase, membrane potential, ion channels, Na/K pump, action potential, myelin, saltatory conduction
Lecture 4 covers how genetic information is stored in DNA, copied, and turned into proteins (the central dogma: DNA to RNA to protein). Lecture 5 then explains how neurons use that molecular machinery to generate electrical signals, from resting membrane potential through the phases of the action potential, and how myelin speeds up signal propagation. Together, these lectures connect the molecular level to neuronal communication.
Gene
The fundamental unit of heredity. A segment of DNA that encodes a protein or functional RNA.
Central dogma
The flow of genetic information: DNA is replicated into DNA, transcribed into mRNA, and translated into protein. DNA → RNA → Protein.
Codon
A sequence of three mRNA nucleotides that codes for one amino acid. Every 3 nucleotides = 1 amino acid.
Complementary base pairing
In DNA: adenine pairs with thymine (A-T), guanine pairs with cytosine (G-C). In RNA, thymine is replaced by uracil (U).
Resting membrane potential
The voltage difference across a neuron's membrane at rest, typically -60 to -80 mV. The inside of the cell is negative relative to the outside.
Na/K ATPase (sodium-potassium pump)
An active transporter that pumps 3 Na+ ions out of the cell and 2 K+ ions into the cell, using ATP. Establishes and maintains the chemical gradient.
Action potential
A rapid, all-or-none electrical signal that propagates along the axon. Triggered when depolarisation reaches threshold.
Depolarisation
The membrane potential becomes less negative (moves toward zero or positive values), driven by Na+ influx.
Repolarisation / Hyperpolarisation
The membrane potential returns toward (and temporarily overshoots past) the resting value, driven by K+ efflux.
Myelin
A fatty insulating sheath formed by oligodendrocytes (in the CNS) that wraps around segments of the axon. Prevents electrical current from leaking out.
Nodes of Ranvier
Gaps between myelin sheaths where voltage-gated sodium channels are concentrated. Allow action potentials to "jump" between nodes.
Saltatory conduction
The process by which action potentials jump from node to node along a myelinated axon, increasing propagation speed roughly tenfold.
Gregor Mendel demonstrated that traits (outward phenotypes) can be segregated and sorted in an orderly fashion during reproduction. His pea plant experiments showed how traits pass across generations, formalised through Punnett squares.
Darwin proposed natural selection: traits that give rise to survival advantages in particular ecological niches are selected for over time.
Key figures in the physics-to-biology bridge:
Niels Bohr: quantum theory of atomic structure, Heisenberg uncertainty principle
Max Delbruck: proposed that genes are large molecules encoding function and reproduction
Thomas Hunt Morgan: demonstrated the role of chromosomes in heredity, showed that genetics could be studied at the macroscale without knowing the physical nature of genes
This experiment determined whether DNA or protein carries genetic information by exploiting the chemical differences between them.
Proteins contain sulfur. Radioactively label sulfur (S-35) and track where it ends up after viral infection of E. coli.
DNA contains phosphorus. Radioactively label phosphorus (P-32) and track where it ends up.
After centrifugation, E. coli (being heavy) forms a pellet at the bottom. The supernatant is the remaining solution.
Result: radioactive phosphorus (DNA) was found in the pellet with the bacteria. Radioactive sulfur (protein) stayed in the supernatant. Conclusion: DNA, not protein, is the genetic material.
DNA is a double helix, described by Francis Crick, James Watson, and Rosalind Franklin.
Base pairing rules: A pairs with T, G pairs with C. This complementarity allows faithful replication.
Practice: given ATGCCACATAGAGGTGCAATTTCTTAA, the complementary strand is TACGGTGTATCTCCACGTTAAAGAATT.
Replication (DNA → DNA)
The double helix unwinds, and each strand serves as a template for a new complementary strand. A-T and G-C pairing ensures accuracy.
Transcription (DNA → mRNA)
A DNA template strand is read and an mRNA strand is produced. The key rule: T in DNA becomes U in RNA.
Study tip: "transcribe" means verbal words to written words, mostly the same language. The nucleotide alphabet stays similar, just T swaps for U.
Practice: template strand TACGGTGTATCTCCACGTTAAAGAATT transcribes to mRNA AUGCCACAUAGAGGUGCAAUUUCUUAA.
The mRNA strand leaves the nucleus and enters the cytoplasm, where ribosomes translate it.
Translation (mRNA → Protein)
Ribosomes read the mRNA three nucleotides at a time (codons). Each codon specifies one amino acid, which is added to the growing polypeptide chain.
Study tip: "translate" means one language to another, nucleotides to amino acids.
Practice: AUGCCACAUAGAGGUGCAAUUUCUUAA breaks into AUG | CCA | CAU | AGA | GGU | GCA | AUU | UCU | UAA, giving Met/Start, Pro, His, Arg, Gly, Ala, Ile, Ser, Stop.
AUG is always the start codon. UAA is a stop codon.
The membrane potential is the voltage difference between the inside and outside of the cell, with the outside defined as the reference (zero).
This voltage arises from the separation of ions by the cell membrane. When ions move across the membrane, the electrical potential changes. This stored energy powers synaptic potentials and action potentials.
At rest, neurons sit at approximately -60 to -80 mV (the resting membrane potential). Two forces maintain this:
The chemical (concentration) gradient, established by the Na/K pump
The electrochemical driving force, charge-based attraction and repulsion
An active transport protein that uses ATP to shuttle ions against their concentration gradients:
Pumps 3 Na+ out of the cell
Pumps 2 K+ into the cell
This creates and maintains the concentration gradients essential for neuronal signalling. Without ATP, the pump cannot function.
Ion channels allow passive movement of ions across the membrane down their concentration gradient (diffusion). They come in two broad types:
Passive/leak channels: always open. Example: leak K+ channels, which allow a constant efflux of K+.
Gated channels: open only under specific conditions (voltage, neurotransmitter binding, light, mechanical force, etc.). They can be selective for particular ions, making the membrane a semipermeable barrier.
Key channel types for action potentials:
Voltage-gated Na+ channels: specific for Na+ influx, open when the membrane depolarises
Voltage-gated K+ channels: specific for K+ efflux, open at depolarised voltages
Leak K+ channels: always open, allow continuous K+ efflux
Two forces drive ion flow during action potentials:
Diffusion down the concentration gradient (set by the Na/K ATPase)
Electrochemical forces (charge interactions from the ion flow itself)
Studied in the giant squid axon by Hodgkin and Huxley.
Resting potential: membrane sits at ~-70 mV
Threshold: sufficient depolarisation triggers voltage-gated Na+ channels to open
Depolarisation: Na+ rushes into the cell, membrane potential shoots toward +30 mV
Repolarisation / Hyperpolarisation: voltage-gated Na+ channels close, voltage-gated K+ channels open, K+ flows out, membrane potential drops back down
Afterhyperpolarisation / Refractory period: membrane potential temporarily overshoots past resting level before returning to baseline
Action potential propagation is:
All or none: the signal either fires at full strength or does not fire at all
Unidirectional: from the axon hillock (high density of voltage-gated Na+ channels) down the axon to the terminals
Oligodendrocytes (a type of glial cell) wrap parts of the axon in myelin, a fatty insulator. Electrical current cannot leak out through myelinated segments, only flow forward.
At the nodes of Ranvier (gaps between myelin sheaths), voltage-gated Na+ channels are concentrated. The action potential "jumps" from node to node. This is saltatory conduction, and it speeds up propagation roughly 10 times compared to unmyelinated axons.
Multiple sclerosis (MS) is an autoimmune disease that damages myelin, disrupting this efficient conduction.
⚠️ Know the base-pairing rules cold: A-T and G-C for DNA; A-U and G-C for RNA. Be able to write complementary strands, transcribe DNA to mRNA, and translate mRNA to amino acids using a codon table.
⚠️ The Hershey-Chase experiment is a classic. Sulfur labels protein, phosphorus labels DNA. DNA ended up in the bacterial pellet, proving it is the genetic material.
⚠️ The Na/K pump moves 3 Na+ out and 2 K+ in. This asymmetry (3 out, 2 in) contributes to the resting membrane potential.
⚠️ Know all five phases of the action potential and what ion movements drive each phase.
⚠️ Saltatory conduction (jumping between nodes of Ranvier) is the mechanism by which myelin speeds up signal transmission. Multiple sclerosis disrupts this.
⚠️ Action potentials are all-or-none and unidirectional. The refractory period prevents backward propagation.
Q: In the Hershey-Chase experiment, why was phosphorus used to label DNA and sulfur to label protein?
A: DNA contains phosphorus (in its phosphate backbone) but no sulfur. Proteins contain sulfur (in certain amino acids) but no phosphorus. Radioactive labels on each element allowed the researchers to track which molecule entered the bacteria.
Q: What is the complementary mRNA strand for the DNA template TACGGTGTATCTCCACGTTAAAGAATT?
A: AUGCCACAUAGAGGUGCAAUUUCUUAA. Apply A-U pairing and G-C pairing (T in DNA becomes A in RNA; A in DNA becomes U in RNA; C becomes G; G becomes C).
Q: Why does the Na/K pump require ATP?
A: It moves ions against their concentration gradients (Na+ out of the cell where Na+ is already more concentrated outside; K+ into the cell where K+ is already more concentrated inside). Moving against a gradient is thermodynamically unfavourable and requires energy input.
Q: What happens during the refractory period of an action potential?
A: The membrane is temporarily hyperpolarised (more negative than resting potential) because voltage-gated K+ channels are still open. During this time, the neuron cannot fire another action potential, which ensures unidirectional propagation and limits firing rate.
Q: How does myelin increase the speed of action potential propagation?
A: Myelin insulates segments of the axon, preventing current leakage. Action potentials jump between nodes of Ranvier (saltatory conduction) rather than propagating continuously along the entire membrane, increasing speed roughly tenfold.
Q: Translate the mRNA sequence AUG CCA CAU AGA into amino acids.
A: Met (start), Pro, His, Arg.
genetics, gene, heredity, Mendel, Punnett square, Darwin, natural selection, Hershey-Chase, blender experiment, DNA, RNA, mRNA, double helix, nucleotides, adenine, thymine, guanine, cytosine, uracil, complementary base pairing, replication, transcription, translation, central dogma, codon, amino acid, start codon, stop codon, ribosome, membrane potential, resting potential, Na/K pump, Na/K ATPase, ion channel, voltage-gated, leak channel, action potential, depolarisation, repolarisation, hyperpolarisation, threshold, refractory period, all or none, axon hillock, myelin, oligodendrocyte, nodes of Ranvier, saltatory conduction, multiple sclerosis, Hodgkin and Huxley, giant squid axon